Creationist crankery flashback: Richard Dawkins stumped?

Recently, I saw a clip on YouTube that uncharacteristically, twinged a feeling of de ja vu but not an actual recollection (uncharacteristic for me; I can usually recall something if I have a memory of it). It was an interview with Richard Dawkins.

Suffice to say, I couldn’t recall the background so I was left to form opinions based on what knowledge I had at hand at the time. I was going to blog about it and point out some mistakes in the implicit message as well as in the triumphalism of the creationist response.

I’ve recently come across accounts of what happened (the missing background information) so the penny has really dropped (add to that there now seems to be a mass YouTube response pointing out the fraud). However, I’ll post the video, then my previous thoughts, before dumping the background story on you.

Response to creationist question

Okay, in answer to the initial creationist question; Flavobacterium Sp. 172 frame-shift mutation allowing the breakdown of nylon. This is the example I’d give to creationists (and have given in the past to the usual response of fingers-in-ears and fallacy) these days, although Dawkins would have had to have used a different mutation as an example given the date of the interview preceding the observation of the mutation of Flavobacterium Sp. 172.

For those who don’t have an understanding of basic genetics (and you’ll need this to get your head around the significance of a frame shift mutation), a strand of nucleic acid is made up of a sequence of four different types of nucleotides. Groups three nucleotides long along the strands of nucleic acid code for a range of amino acids, based on the combination of the four types of nucleotides (4 x 4 x 4 giving a total of 64 possible combinations for each group of three).

A bit abstract so far I know. Please bear with me.

Now, when a group of three nucleotides codes for the amino acid methionine, this is a start codon. It signals the start of a sequence of amino acids.

There are a number of combinations of three nucleotides that form a stop codon and when such combinations are reached during translation it signals the end of a sequence of amino acids. Including the amino acid corresponding to the start codon (methionine), these sequences of amino acids are linked together (by way of a condensation reaction in the ribosome) to form peptides, or in layman’s terms; proteins.

Insulin, histamine, dopamine, adrenalin, growth hormone, IGF-1, blood clotting factors, digestive enzymes and a whole host of other peptides your body needs to function properly are formed at least initially by this process. The sequence of amino acids to make these important hormones/enzymes are translated from your genes.

You can probably work out now what may happen to these enzymes and hormones in people who inherit mutations to the nucleotide sequences coding for them. Tay-Sachs disease is an example, with a range of possible inherited mutations to chromosome 15 damaging the sequence (aka gene) for beta-N-acetylhexosaminidase A; an enzyme that prevents build-ups of gangliosides in the neurons of the brain.

In any case, put a simply as I can, a frame-shift mutation (such as in the example I and others have used to rebut the creationist question) is one where the sequence of nucleotides is altered by the insertion or deletion of a number of nucleotides not divisible by three. This doesn’t just add or take away genetic information, it alters the way existing genetic material is interpreted.

Take for example a hypothetical strand of RNA (AUGGUCAUACUGCAGUAGUAUAUAAAA*) and the amino acid sequence it codes for;

AUG Methionine (START CODON)
GUC Valine
AUA Isoleucine
CUG Leucine
CAG Glutamine
UAG STOP CODON
UAU Tyrosine**
AUA Isoleucine**
AAA Lysine**

* A, U, G and C represent the 4 types of nucleotide (base pairs) in RNA.

** Nucleotides following a “STOP” without a “AUG” for methionine to start things off again, as can be expected, are not translated.

Translated from top-to bottom, this would give us a peptide 5 amino acids long in the sequence of methionine, valine, isoleucine, leucine and finally glutamine. But look what happens if we add just two nucleotides (“AA”) early in the sequence.

AUG Methionine
AAG Lysine
UCA Serine
UAC Tyrosine
UGC Cysteine
AGU Serine
AGU Serine
AUA Isoleucine
UAA STOP
AA (codes for nothing)

With the addition of just two nucleotides, we now have an 8 amino acid long polypeptide with the sequence of methionine, lysine, serine, tyrosine, cysteine, serine, serine, isoleucine. There was no serine in the original sequence, now the peptide is serine rich.

There was no cysteine in the original, and the addition of a cysteine is significant because cysteine can form di-sulphide bonds; if there was a second cysteine elsewhere in the sequence the two cysteines could have bound together folding the peptide into a loop.

In short, a frame-shift mutation can radically alter a peptide/protein, altering the amino acids in the sequence and if displacing stop codons, possibly resulting in a much larger and complex peptide. This is what happened in Flavobacterium Sp. 172; the resultant peptide being “nylonase”, an enzyme that can break down nylon.

Now if we want to talk “information” with the creationists, have a look at the amount of information coding for the two different peptides. Pre and post mutation it’s a ratio of 5:8. And no, the “lost” tyrosine, isoleucine and lysine at the end of the original sequence don’t count as “information”; they weren’t translated in the first place.

Not all mutations are deleterious like those causing Tay-Sachs and some mutations can lead to an “increase in information”. It’s called evolution folks.

Richard Dawkins’ Response

Richard Dawkins talks about intermediates, and the common fallacy that we are descended from modern animals. From what I gathered when I first watched the clip, I gathered Richard Dawkins was trying to ascertain the premise behind the question he was asked.

Indeed, his question does address the modus operandi of the creationists who ask these kinds of “God of the gaps” questions. The creationist finds an area where a scientific theory has not been fully researched, points to the gap in knowledge and claims victory by default (the victory being short lived once the gap is filled in with the results of research; see where “irreducible complexity” meets the sea sponge.)

If the intermediates that Dawkins talks about were alive today alongside their modern counterparts, we could easily undertake genetic research into their differences and the “increases in information”. However, the reality that they aren’t around makes research in evolutionary biology difficult and inevitably means that there will be gaps in our knowledge of the genetic history of life on Earth.

Indeed, if we are to turn the creationists’ absurdity back on themselves so that we could “win by default” and take advantage of practical obstacles to research, we could ask all sorts of silly questions. “Creationist, are you aware of any genetic testing directly confirming the paternal status of Adam to any modern member of the human race?”

The “no example of an increase in information” meme is just another in the series of “God of the gaps” canards doing the rounds by means of the uncritical parroting of a faithful but unthinking and opportunistic movement. Dawkins’ response, while awkward, is actually on topic, although you may be forgiven for thinking otherwise.

The missing details

And this is Dawkins’ account of what happened behind the scenes.

In September 1997, I allowed an Australian film crew [from the then Answers in Genesis] into my house in Oxford without realising that their purpose was creationist propaganda. In the course of a suspiciously amateurish interview, they issued a truculent challenge to me to “give an example of a genetic mutation or an evolutionary process which can be seen to increase the information in the genome.” It is the kind of question only a creationist would ask in that way, and it was at this point I tumbled to the fact that I had been duped into granting an interview to creationists – a thing I normally don’t do, for good reasons. In my anger I refused to discuss the question further, and told them to stop the camera. However, I eventually withdrew my peremptory termination of the interview as a whole. This was solely because they pleaded with me that they had come all the way from Australia specifically in order to interview me. Even if this was a considerable exaggeration, it seemed, on reflection, ungenerous to tear up the legal release form and throw them out. I therefore relented.

My generosity was rewarded in a fashion that anyone familiar with fundamentalist tactics might have predicted. When I eventually saw the film a year later 1, I found that it had been edited to give the false impression that I was incapable of answering the question about information content 2. In fairness, this may not have been quite as intentionally deceitful as it sounds. You have to understand that these people really believe that their question cannot be answered! Pathetic as it sounds, their entire journey from Australia seems to have been a quest to film an evolutionist failing to answer it.”

(Richard Dawkins, 1998)

Grrrr…. Barry Williams wrote about the alleged scam in a 1998 edition of The Skeptic. His analysis can be found here.

Well I’m off to bed now. Nite, nite.

~ Bruce

59 thoughts on “Creationist crankery flashback: Richard Dawkins stumped?

  1. What Rafael wrote plus that fact that God talked to me kind of answers all of your questions, doesn’t it.

    Rafael, that was long but excellently written.

    Like

  2. This is one small piece of proof that God talked to me:

    Like I said earlier, the Holy Spirit talked to me, besides his message about First is Last and Last is First, he had something to say about “Who Killed JFK”. Christ tells me that the man who shot JFK is a policeman. He also tells me the name of the shooter, but it is in a jumbled word. The word is “Fritters”. I see the name F. Ritter right off so I think that is the name of the killer. Now God has lots of other messages for me to figure out, so I put “who Killed JFK” on the back burner for over a year. A year or more later , just recently, I have more time to look for F. Ritter. I can’t find a policeman with that name who lived in Dallas, Texas in 1963. So I am searching for information about who killed JFK and there is a picture of a policeman by the name of J D Tippit. Now Tippit kind of looks like Ritter. Now I unjumble the letters of Ritter to get TIRRET. Now TIRRET looks more like TIPPIT. Now I make the R’s stand at attention, I get TIPPET. One problem is that the I and the E are not the same. So I do some research on the family name TIPPIT. Turns out that in the late 1800’s JD Tippit’s grandfather changed their name from Tippett to Tippit. So the next step I change the E to I. So Tippet is now Tippit.
    Now I have FS Tippit and JD Tippit. The first two initials are not the same. Next I go to Wikipedia there I find; “Some thought that J D stood for “Jefferson Davis” however JD does not stand for anything”. That means his name is just J D. So the initials F S , do not stand for anything. I just have two initials that do not stand for anything. Are you following me?

    Next what does “FRITTERS” mean. If your following my thinking here, God is going to tell you what happened to JD Tippit after he was shot. Fritters are a dough that is deep fried. Bread also means body, like in the last super Christ takes the bread and says this is my body. Look in the dictionary, PIT means HELL. TIP means money paid, gratuity. There are other meanings to. These meanings tell a story.

    JD Tippits body (dough) is placed in the deep fryer (lake of fire). Now I think this clue (Fritters) was ingenius. After all God came up with it. I think he does have a sense of humor too. Kids now have a new game to play. They can play God. Pillsbury dough boy fry’s in the lake of fire. You get HELL! fry baby fry!

    If you think this is just crazy. Remember I am just the messenger. Jesus is the one that had to talk about JFK. So he had a reason for doing that. Only God knows who the killer is. This is proof that Christ talked to me and that is the reason he told me “Who killed JFK”. It is proof. I had forgotten about the case years ago. This is a cold case now, it been 45 years since the shooting.

    I also read the part about giving false prophesy. God says false prophets go to Hell or something like that. I only repeat what God told me. Now what I wrote above is from God. He told me who killed JFK in 2006. The above is not a lie or a joke and I am going to HEAVEN without fear.

    Before I forget. Gods messeges usually have more than one meaning. F S could also stand for “Fence Shooter”.

    Who are the co-conspirators? Turns out that there are two policemen named Tippit, and one Tippett working in the Dallas police Department that same year(1963). Back to the clue word Fritters. That is plural, you know about plural. We have two fritters. The co-conspirators name is Gayle M. Tippit.

    Now the Dallas Police Department obviously covered up and framed Oswald. He was the Patsy. They did it cause it is very possible that one of the other police officers rushing to the scene saw Tippet fleeing the scene carrying a rifle. They covered it up because of the embarrassment of one of their own was the man that killed JFK? And the Warren commission must have also figured that out so they stuck with the Dallas Dept. story saying that it was Oswald. It could have been a National embarrassment. Now if you look at the evidence like I did. It is easy to see that the DAllas Police Dept tampered with the evidence over and over again. And they did a very bad job of it too.

    Now this is my opinion, not Gods. I think God is behind the creation of the Internet. I could never have been able to figure out a lot of his messages without the use of the Internet. People on the Net have been a big help to me. God talks to other people too, they just don’t know it. God let me know it was him.

    Now I just made solving the case of “Who shot JFK?”, look easy. I also gave you proof here. Did you see it? You ask where’s the proof. The proof is that it is impossible for anyone to repeat what I just did above. I mean try it. And I do that over and over again in all of God’s messages.
    See if you can make up a word that is a fried food (like fritters). Unjumble the letters to reveal the name of the killer (Tippit). Then divide the word Tippit into words that describe what happened. Tip- means that JD Tippit was paid for the job and the presidency was over turned. Pit – means that he went to Hell for what he did. Pit means the worst Hell.

    See if you can prove me wrong. Show me how easy it is to make up a name like “Fritters” that solves the crime. This clue is ingenious. God came up with the name “FRITTERS”. God is a genius, not me. I am only the messenger.

    Then the two remaining letters F. S. stands for Fence Shooter. It’s INGENIUS!

    Then on top of that it just so happens that there are two Tippit’s working in the Dallas Police Department in 1963. Fritters (plural) means we have more than one Fritter going in the deep fryer . The other shooter is Gayle M. Tippit. He goes to Hell too. Now I did some research on Gayle M Tippit. There is very little information on him unlike JD Tippit. In my search I found two Gayle Tippit’s still in Dallas. One died in 1967 and the other is married and still lives in Texas. So the other conspirator could still be alive and has managed to avoid detection.

    This is where it gets intesting. Does Gayle M. Tippit come forward and ask God to forgive him? I think he also has to ask the American people to forgive him for his part in the murder of the president or he gets the worst Hell just like JD did. God told me that waiting until the 11th hour is too late. God is forgiving, but you can’t wait until your on your death bed to ask to be forgiven.

    Now if Gayle M. Tippit wants to save himself from the deep fryer. (This could be a long fry, not a quick dip.) He has to come forward and ask to be forgiven. He still gets death or Hell but it won’t be the worst Hell. Just like the worst death is being crucified.

    Gods Messenger, Melanie

    Note: The fact is that it is impossible for you or anyone to come up with a clue like “Fritters”. And I can do that over and over again. You can’t come up with anything that is as ingenius as “Fritters”. Fritters are donuts you know. I always see a cop at the Dunkins Donuts. They make donuts from bad cops you know. Bad cops go in and they don’t come out. I think that is funny. Donuts are really deep fried cops. Next time you have a donut you can think about it. Your really eating a cop.

    Like

  3. Its funny at the very start of this commentary I came across a precious commentory from Malane Stephen and I thought WOW what a complete whack job she must be and then presto I get to this point and see her latest comments and now I see that she is actually STARK RAVING mad, anyone who can write such mumbe jumbo space cadet tripe should be sedated for their own and our safety, cuckoo cuckoo cuckoo

    Like

  4. Hy Mln , Cck cck cck.

    Moderator’s note: Disemvoweled for trolling. Or counter-trolling. Or whatever. Please don’t bait the trolls, especially the trolls that (at least in theory) can’t respond due to a ban.

    Like

  5. I saw the Pope on the news tonight. Now God did not pick the Pope. God picked me over the Pope. I found that interesting. Now I like the Pope very much. I now realize why God picked me over the Pope…

    As always, Melanie

    Moderator’s Note: Post snipped for insanity and threats of hellfire and brimstone.

    Like

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Google+ photo

You are commenting using your Google+ account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s

This site uses Akismet to reduce spam. Learn how your comment data is processed.