Creationist crankery flashback: Richard Dawkins stumped?

Recently, I saw a clip on YouTube that uncharacteristically, twinged a feeling of de ja vu but not an actual recollection (uncharacteristic for me; I can usually recall something if I have a memory of it). It was an interview with Richard Dawkins.

Suffice to say, I couldn’t recall the background so I was left to form opinions based on what knowledge I had at hand at the time. I was going to blog about it and point out some mistakes in the implicit message as well as in the triumphalism of the creationist response.

I’ve recently come across accounts of what happened (the missing background information) so the penny has really dropped (add to that there now seems to be a mass YouTube response pointing out the fraud). However, I’ll post the video, then my previous thoughts, before dumping the background story on you.

Response to creationist question

Okay, in answer to the initial creationist question; Flavobacterium Sp. 172 frame-shift mutation allowing the breakdown of nylon. This is the example I’d give to creationists (and have given in the past to the usual response of fingers-in-ears and fallacy) these days, although Dawkins would have had to have used a different mutation as an example given the date of the interview preceding the observation of the mutation of Flavobacterium Sp. 172.

For those who don’t have an understanding of basic genetics (and you’ll need this to get your head around the significance of a frame shift mutation), a strand of nucleic acid is made up of a sequence of four different types of nucleotides. Groups three nucleotides long along the strands of nucleic acid code for a range of amino acids, based on the combination of the four types of nucleotides (4 x 4 x 4 giving a total of 64 possible combinations for each group of three).

A bit abstract so far I know. Please bear with me.

Now, when a group of three nucleotides codes for the amino acid methionine, this is a start codon. It signals the start of a sequence of amino acids.

There are a number of combinations of three nucleotides that form a stop codon and when such combinations are reached during translation it signals the end of a sequence of amino acids. Including the amino acid corresponding to the start codon (methionine), these sequences of amino acids are linked together (by way of a condensation reaction in the ribosome) to form peptides, or in layman’s terms; proteins.

Insulin, histamine, dopamine, adrenalin, growth hormone, IGF-1, blood clotting factors, digestive enzymes and a whole host of other peptides your body needs to function properly are formed at least initially by this process. The sequence of amino acids to make these important hormones/enzymes are translated from your genes.

You can probably work out now what may happen to these enzymes and hormones in people who inherit mutations to the nucleotide sequences coding for them. Tay-Sachs disease is an example, with a range of possible inherited mutations to chromosome 15 damaging the sequence (aka gene) for beta-N-acetylhexosaminidase A; an enzyme that prevents build-ups of gangliosides in the neurons of the brain.

In any case, put a simply as I can, a frame-shift mutation (such as in the example I and others have used to rebut the creationist question) is one where the sequence of nucleotides is altered by the insertion or deletion of a number of nucleotides not divisible by three. This doesn’t just add or take away genetic information, it alters the way existing genetic material is interpreted.

Take for example a hypothetical strand of RNA (AUGGUCAUACUGCAGUAGUAUAUAAAA*) and the amino acid sequence it codes for;

AUG Methionine (START CODON)
GUC Valine
AUA Isoleucine
CUG Leucine
CAG Glutamine
UAG STOP CODON
UAU Tyrosine**
AUA Isoleucine**
AAA Lysine**

* A, U, G and C represent the 4 types of nucleotide (base pairs) in RNA.

** Nucleotides following a “STOP” without a “AUG” for methionine to start things off again, as can be expected, are not translated.

Translated from top-to bottom, this would give us a peptide 5 amino acids long in the sequence of methionine, valine, isoleucine, leucine and finally glutamine. But look what happens if we add just two nucleotides (“AA”) early in the sequence.

AUG Methionine
AAG Lysine
UCA Serine
UAC Tyrosine
UGC Cysteine
AGU Serine
AGU Serine
AUA Isoleucine
UAA STOP
AA (codes for nothing)

With the addition of just two nucleotides, we now have an 8 amino acid long polypeptide with the sequence of methionine, lysine, serine, tyrosine, cysteine, serine, serine, isoleucine. There was no serine in the original sequence, now the peptide is serine rich.

There was no cysteine in the original, and the addition of a cysteine is significant because cysteine can form di-sulphide bonds; if there was a second cysteine elsewhere in the sequence the two cysteines could have bound together folding the peptide into a loop.

In short, a frame-shift mutation can radically alter a peptide/protein, altering the amino acids in the sequence and if displacing stop codons, possibly resulting in a much larger and complex peptide. This is what happened in Flavobacterium Sp. 172; the resultant peptide being “nylonase”, an enzyme that can break down nylon.

Now if we want to talk “information” with the creationists, have a look at the amount of information coding for the two different peptides. Pre and post mutation it’s a ratio of 5:8. And no, the “lost” tyrosine, isoleucine and lysine at the end of the original sequence don’t count as “information”; they weren’t translated in the first place.

Not all mutations are deleterious like those causing Tay-Sachs and some mutations can lead to an “increase in information”. It’s called evolution folks.

Richard Dawkins’ Response

Richard Dawkins talks about intermediates, and the common fallacy that we are descended from modern animals. From what I gathered when I first watched the clip, I gathered Richard Dawkins was trying to ascertain the premise behind the question he was asked.

Indeed, his question does address the modus operandi of the creationists who ask these kinds of “God of the gaps” questions. The creationist finds an area where a scientific theory has not been fully researched, points to the gap in knowledge and claims victory by default (the victory being short lived once the gap is filled in with the results of research; see where “irreducible complexity” meets the sea sponge.)

If the intermediates that Dawkins talks about were alive today alongside their modern counterparts, we could easily undertake genetic research into their differences and the “increases in information”. However, the reality that they aren’t around makes research in evolutionary biology difficult and inevitably means that there will be gaps in our knowledge of the genetic history of life on Earth.

Indeed, if we are to turn the creationists’ absurdity back on themselves so that we could “win by default” and take advantage of practical obstacles to research, we could ask all sorts of silly questions. “Creationist, are you aware of any genetic testing directly confirming the paternal status of Adam to any modern member of the human race?”

The “no example of an increase in information” meme is just another in the series of “God of the gaps” canards doing the rounds by means of the uncritical parroting of a faithful but unthinking and opportunistic movement. Dawkins’ response, while awkward, is actually on topic, although you may be forgiven for thinking otherwise.

The missing details

And this is Dawkins’ account of what happened behind the scenes.

“In September 1997, I allowed an Australian film crew [from the then Answers in Genesis] into my house in Oxford without realising that their purpose was creationist propaganda. In the course of a suspiciously amateurish interview, they issued a truculent challenge to me to “give an example of a genetic mutation or an evolutionary process which can be seen to increase the information in the genome.” It is the kind of question only a creationist would ask in that way, and it was at this point I tumbled to the fact that I had been duped into granting an interview to creationists – a thing I normally don’t do, for good reasons. In my anger I refused to discuss the question further, and told them to stop the camera. However, I eventually withdrew my peremptory termination of the interview as a whole. This was solely because they pleaded with me that they had come all the way from Australia specifically in order to interview me. Even if this was a considerable exaggeration, it seemed, on reflection, ungenerous to tear up the legal release form and throw them out. I therefore relented.

My generosity was rewarded in a fashion that anyone familiar with fundamentalist tactics might have predicted. When I eventually saw the film a year later 1, I found that it had been edited to give the false impression that I was incapable of answering the question about information content 2. In fairness, this may not have been quite as intentionally deceitful as it sounds. You have to understand that these people really believe that their question cannot be answered! Pathetic as it sounds, their entire journey from Australia seems to have been a quest to film an evolutionist failing to answer it.”

(Richard Dawkins, 1998)

Grrrr…. Barry Williams wrote about the alleged scam in a 1998 edition of The Skeptic. His analysis can be found here.

Well I’m off to bed now. Nite, nite.

~ Bruce